More Information
Submitted: 18 June 2019 | Approved: 04 July 2019 | Published: 05 July 2019
How to cite this article: Elmaraghy N, Abbadi S, Elhadidi G, Hashem A, Yousef A. Virulence Genes in Pseudomonas Aeruginosa Strains Isolated at Suez Canal University Hospitals with Respect to the Site of Infection and Antimicrobial Resistance. Int J Clin Microbiol Biochem Technol. 2019; 2: 008-019.
DOI: 10.29328/journal.ijcmbt.1001006
Copyright: © 2019 Elmaraghy N, et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Keywords: Biofilm; Virulence genes; P. aeruginosa; Antimicrobial resistance; Egypt
Virulence Genes in Pseudomonas Aeruginosa Strains Isolated at Suez Canal University Hospitals with Respect to the Site of Infection and Antimicrobial Resistance
Nermine Elmaraghy1*, Said Abbadi2, Gehan Elhadidi3, Asmaa Hashem4 and Asmaa Yousef5
1Associate Professor of Medical Microbiology, Department of Medical Microbiology &Immunology; Faculty of Medicine Suez Canal University; Ismailia, Egypt
2Professor of Medical Microbiology, Department of Medical Microbiology & Immunology Faculty of Medicine, Suez University, Suez, Egypt
3Professor of Medical Microbiology, Department of Medical Microbiology & Immunology Faculty of Medicine, Suez Canal University, Ismailia, Egypt
4Lecturer of Medical Microbiology, Department of Medical Microbiology & Immunology Faculty of Medicine, Suez Canal University, Ismailia, Egypt
5Lecturer of Medical Microbiology Department of Medical Microbiology & Immunology Faculty of Medicine, Suez Canal University, Ismailia, Egypt
*Address for Correspondence: Nermine Elmaraghy, Associate Professor of Medical Microbiology, Department of Medical Microbiology & Immunology Faculty of Medicine, Suez Canal University, Ismailia, Egypt, Tel: 002/01224117033; Email: [email protected]
Background: Pseudomonas aeruginosa is one of the top five pathogens causing healthcare-associated infections. Biofilm formation is nowadays a major problem. Aim: The aim of this study was to examine the prevalence of virulence genes in clinical isolates of Pseudomonas aeruginosa at Suez Canal University Hospitals with respect to the site of infection and microbial resistance of the strains.
Materials and methods: A cross-sectional descriptive study was carried out on 47 Pseudomonas aeruginosa strains collected from hospitalized patients from December 2015 to August 2017. To detect biofilm formation, we used Tissue Culture Plate Method. The virulence genes (toxA, algD, nan1, pslA and pelA) were amplified using PCR technique.
Results: The highest sensitivity was to Imipenem and Ciprofloxacin (85.1% and 68.1% respectively).With respect to the virulence genes, toxA gene was detected in 45 isolates (95.7%), algD gene in 42 isolates (89.4%), pslA in 42 isolates (89.4%) %), pelA cted in 41 isolates (87.2%) and nan1gene was detected in 19 isolates (40.45%).
Conclusions and Recommendations: We conclude that there is relationship between virulence genes and biofilm formation in Pseudomonas aeruginosa. We recommend the expansion of work on a larger sample size in a longer period of time.
Pseudomonas aeruginosa (P. aeruginosa) is considered one of the most prevalent nosocomial organisms associated with high mortality rates and one with the highest prevalence of antibiotic resistance. It is one of the top five pathogens causing Healthcare Associated Infection (HAI) [1]. In Egypt, it can be responsible for HAI in Intensive Care Unit (ICU) and Burn Unit: 17 % and 21.6% respectively [2,3].
P. aeruginosa is considered multi-drug resistant (MDR) bacteria. As by definition, P. aeruginosa MDR was defined bacteria resistant at least to three drugs mainly aminoglycosides, antipseudomonal penicillins, cephalosporins, carbapenems and fluoroquinolones [4]. The mechanisms of drug resistance are intrinsic and acquired. This resistance is mediated through several mechanisms including multidrug efflux systems, enzyme production, outer membrane protein loss and target mutations [5]. For virulence, P. aeruginosa possesses extracellular virulence factors controlled by a complex regulatory circuit involving oquorum sensing (QS) thus producing these factors in a coordinated manner [6].
The biofilm formation which reflects a community of cells attached to either a biotic or an abiotic surface and enclosed in a complex exopolymeric substance is nowadays a major problem as it increases the potential of the pathogen to be resistant to antibiotics and disinfectants [7], is difficult to be eradicated and contributes to localized or systemic inflammation, which prolongs wound healing [8]. P. aeruginosa produces at least three polysaccharides {alg (alginate), Pel (pellicle), and Psl} which plays an important role in the stability of the biofilm structure [9]. To overcome this phenomenon, different strategies have been proposed in order to (i) avoid microbial attachment to a surface, (ii) disrupt biofilm development to increase the penetration of antimicrobials; and (iii) affect biofilm maturation [10].
The aim of this study is to examine the prevalence of virulence genes in clinical isolates of P. aeruginosa isolated from Suez Canal University Hospitals (SCUH) in respect to the site of infection and antimicrobial resistance of the strains.
A cross-sectional descriptive study was carried out from December 2015 to August 2017 at SCUH on 47 P. aeruginosa strains collected from hospitalized patients who were suffering from Urinary Tract Infection (UTI), Respiratory Tract Infection (RTI),burn infection, bed ulcers, wound infections and bacteremia in Suez Canal University Hospitals(SCUHs) in Ismailia.
Various clinical specimens were collected from hospitalized patients and processed in the Medical Microbiology and Immunology department SCUHs for the isolation and identification of P. aeruginosa.
The collected specimens were inoculated onto blood agar, MacConkey’s agar and Pseudomonas agar P plates. Then the plates were incubated aerobically at 35± 2˚C for 24 hours. Colonies on blood agar and MacConkey’s agar suspected to be P. aeruginosa (by their colonial morphology, being non-lactose fermenter on MacConkey’s agar and gram negative bacilli by gram stain) were confirmed to be P. aeruginosa by oxidase test and by production of the blue phenazine pigment pyocyanin on Pseudomonas Agar P which is absolute confirmation of a strain as P. aeruginosa [11].
We used quality control strain P. aeruginosa ATCC 27853. According to Clinical and Laboratory Standards Institute (CLSI) [12], the following antibiotic discs were used as follows: Pipracillin-Tazobactam 100/10µg as β- Lactamase inhibitors, Ceftazidime 30µg and Cefepime 30µg (third and fourth generation Cephalosporins respectively), Azetronam 30µg as Monbactams, Imepenem 10µg and Merpenem 10µg for Carbapenems, Gentamycin 10µg and Amikacin 30µg for Aminoglycosides, Ciprofloxacin 5µg and Levofloxacin 5µg as second and third generation Fluoroquinolones respectively and Colisitin 10µg for Lipopeptides.
To detect biofilm formation, we used Tissue Culture Plate Method (TCP) [13] as follows: overnight isolates from fresh agar plate (24 hours at 37°C) were diluted 100 folds in trypticase soy broth. Then 200 μL of this suspension were inoculated into a 96-well flat-bottomed polystyrene plate, covered and incubated overnight at 37°C. Each well was washed four times with 200 µl of phosphate buffer saline (pH 7.2) in order to remove free-floating planktonic bacteria. For the non-adherent bacteria, the plates were severely shaken to get rid of it. After drying the plates, the wells were stained with 200 μL of crystal violet for 15 minutes (dye was dissolved with 200 μL of ethanol 95%). The optical density (OD) at 630nm was recorded and the results were interpreted [14].
Table 1 shows the mean Optical density (OD) to detect the biofilm formation by using TCP method.
| Table 1: Classification of bacterial adherence and biofilm formation by TCP method. | |
| Mean OD value at 630nm | Biofilm production |
| < 0.120 | Non/weak |
| 0.120 - 0.240 | Moderate |
| > 0.240 | Strong |
The virulence genes (toxA, algD, nan1, pslA and pelA) were amplified by PCR using a specific set of primers listed in table 2.
| Table 2: Primers that were used for amplification of virulence genes.. | ||
| Target Gene | Oligonucleotide Sequence (5’-3’) | Amplicon Size (bp)* |
| toxA (Sabharwalet al., 2014) | 150 bp | |
| -F** | GGAGCGCAACTATCCCACT | |
| -R*** | TGGTAGCCGACGAACACATA | |
| nan1(Corehtashet al., 2015) | 1317 bp | |
| -F | ATG AAT ACT TAT TTT GAT AT | |
| -R | CTA AAT CCA TGC TCT GAC CC | |
| algD (Lanotte et al., 2004) | 1310 bp | |
| -F | ATG CGA ATC AGC ATC TTT GGT | |
| -R | CTA CCA GCA GAT GCC CTC GGC | |
| pelA(Colvinet al.,2011) | 118 bp | |
| -F | CCTTCAGCCATCCGTTCTTCT | |
| -R | TCGCGTACGAAGTCGACCTT | |
| pslA(Maita and Boonbumrung ,2014). | 656 bp | |
| -F | TCCCTACCTCAGCAGCAAGC | |
| -R | TGTTGTAGCCGTAGCGTTTCTG | |
Bacterial DNA for the PCR analysis was prepared using the bacterial DNA extraction kit (Sigma) following the manufacturer’s instructions. PCR was carried out with 2 μL template DNA, 0.25 μM of each primer, 0.2 mM deoxyribonucleoside triphosphates, 1x reaction buffer, 2 mM MgCl2 and 1.5U Prime Taq DNA polymerase in a total volume of 25 μL.
For toxA, nan1 and algD genes, the DNA was amplified using the following protocol: initial denaturation (94 ºC for 5 minutes) followed by 30 cycles of denaturation (94 ºC for 40 seconds), annealing (55 ºC, from 45 seconds to 1 minute) and extension (72 ºC, from 45 seconds to 1 minute 35 seconds), with a single final extension of 7 minutes at 72 ºC [6].
For pelA and pslA genes, the DNA was amplified using the following protocol: initial denaturation (5 minutes at 94°C) followed by 30 seconds-35 cycles of denaturation at 94°C, 40 seconds of annealing at 52°C and 50 seconds of extension at 72°C.The amplified products were held at -20°C until analysis [15].
PCR products were separated in 1% agarose gel for 50–110 minutes at 120 volts, stained with ethidium bromide (0.5g/ml) and detected by ultraviolet trans-illumination (wavelength 312 nm).
Ethical considerations
The study work obtained approval from the Ethics Committee of Faculty of Medicine, Suez Canal University (FOMSCU), Ismailia, Egypt.
Statistical analysis
The data collected were entered into a database file. Statistical analysis was performed by using the SPSS 22 software statistical package. Qualitative data was summarized in frequencies. For a subsequent analysis of data, chi square test was used to detect the difference between qualitative data. The outcome variables included sex, type of specimen, hospital wards, biofilm formation, drug susceptibility and MDR. Statistical significance was considered at p. value ≤ 0.05.
This study was carried out on 47 P. aeruginosa isolates that were collected from 296 patients who had HAIs after 24-48 hours of admission in SCUHs in Ismailia during the period from December 2015 to August 2017.
P. aeruginosa was defined. In regard to its percentage in relation to sex, it was found out that it was higher among males than females (55.3% versus 44.7%). With reference to its percentage among different age groups, it was the highest among age group ≥50 years (21.3%) and the lowest from the age group 10 - 40 years (8.5%).
With regard to the percentage of P. aeruginosa in different hospital wards, the highest percentage was found in cases in the ICU (29.8%), while the lowest percentage was in pediatrics department (6.4%).
The highest percentage of P. aeruginosa was isolated from pus of the wounds and burns (38.3%), then 31.9% from urine, 19.1% from sputum and 10.6% from blood samples.
Testing the antibiotic susceptibility pattern of the isolated strains showed that the highest sensitivity was to Imipenem and Ciprofloxacin (85.1% and 68.1% respectively), while the highest prevalence of resistance was to Cefepime and Ceftazidime (68.1% for each of them) (Table 3).
| Table 3: The results of antibiotic susceptibility pattern of the isolated strains. | ||
No. | Antibiotic | Resistance |
| No. (%) | ||
| 1 | Imipenem | 7 (14.9%) |
| 2 | Ciprofloxacin | 15 (31.9%) |
| 3 | Amikacin | 17 (36.2%) |
| 4 | Meropenem | 18 (38.3%) |
| 5 | Colistin | 18 (38.3%) |
| 6 | Gentamicin | 21 (44.7%) |
| 7 | Levofloxacin | 22 (46.8%) |
| 8 | Pipracillin\ tazobactam | 25 (53.2%) |
| 9 | Azetronam | 27 (57.4%) |
| 10 | Ceftazidime | 32 (68.1%) |
| 11 | Cefepime | 32 (68.1%) |
Twenty eight strains were MDR (59.6%) and 19 strains were non MDR (40.4%) out of 47 P. aeurginosa strains.
Testing the resistance pattern of the MDR and non MDR strains showed that; the highest prevalence of resistance for MDR strains was to Azetronam and Cefepime (92.85% for each) and the highest prevalence of resistance for non MDR strains was to Levofloxacin and Meropenem (47.36% for each) (Table 4).
| Table 4: The resistance pattern of the Multi Drug Resistant and Non Multi Drug Resistant strains among the studied population (n=47). | |||
| No. | Antibiotic | Multi Drug Resistant (N=28) | Non Multi Drug Resistant (n=19) |
| No. (%) | No. (%) | ||
| 1 | Azetronam | 26 (92.85%) | 1 (0.05%) |
| 2 | Cefepime | 26 (92.85%) | 6 (31.57%) |
| 3 | Ceftazidime | 25 (89.28%) | 7 (36.84%) |
| 4 | Pipracillin-tazobactam | 23 (82.14%) | 2 (10.5%) |
| 5 | Gentamicin | 16 (57.14%) | 5 (26.31%) |
| 6 | Levofloxacin | 13 (46.4%) | 9 (47.36%) |
| 7 | Amikacin | 13 (46.4%) | 4 (21.1%) |
| 8 | Coilstin | 11 (39.28%) | 7 (36.84%) |
| 9 | Ciprofloxacin | 10 (35.71%) | 5 (26.31%) |
| 10 | Meropenem | 9 (32.14%) | 9 (47.36%) |
| 11 | Imipenem | 4 (14.28%) | 3 (15.78%) |
For biofilm production, results showed that 13 strains out of 47 (27.7%) were strong biofilm producers, 10 strains (19.1%) moderate biofilm producers and 24 strains (51.1%) weak or non-biofilm producers .
Testing the relation between biofilm production and different sites of infection showed that the percentage of biofilm formation is higher among sputum and blood specimens than others (Table 5).
| Table 5: The relation between biofilm production and different sites of infection. | |||||
| Biofilm production | The different sites of infection | ||||
| Pus | Urine | Sputum | Blood | P value | |
| Strong biofilm producer No. (%) | 4 (22.2%) | 4 (26.66%) | 3 (33.33%) | 2 (40%) | 0.850 |
| Moderate biofilm producer No. (%) | 2 (11.11%) | 4 (26.66%) | 2 (22.22%) | 2 (40%) | 0.490 |
| Non biofilm producer No. (%) | 12 (66.66%) | 7 (46.66%) | 4 (44.44%) | 1 (20%) | 0.147 |
| Total No. (%) | 18 (38.3%) | 15 (31.9%) | 9 (19.1%) | 5 (10.6%) | |
| P value˂0.05 significant | |||||
According to the antibiotic susceptibility pattern of both biofilm- producing and nonbiofilm- producing isolates, it was found that biofilm- producing strains had high prevalence of resistance to Ciprofloxacin (80%), followed by Azetronam (70%), Gentamicin (66.6%), Amikacin (64.7%), Pipracillin-Tazobactam (64%) and Cefepime and Ceftazidime (59.4% for each). The resistance pattern to Ciprofloxacin, Gentamicin, Cefepime, Ceftazidime, Azetronam and Pipracillin-Tazobactam was significantly higher (p. value ≤0.05) among biofilm producers than non-biofilm producers as shown in table 6.
| Table 6: The antibiotic susceptibility pattern of both biofilm producing and non-biofilm producing isolates. | ||||
| No. | Antibiotic | Biofilm producer (n=23) | Non biofilm producer (n=24) | P value |
| No. (%) | No. (%) | |||
| 1 | Ciprofloxacin | 12 (52.17%) | 3 (12.5%) | 0.005 |
| 2 | Levofloxacin | 12 (52.17%) | 10 (41.67%) | 0.564 |
| 3 | Meropenem | 7(30.43%) | 11 (45.83%) | 0.371 |
| 4 | Imipenem | 4 (17.39%) | 3 (12.5%) | 0.701 |
| 5 | Gentamicin | 14 (60.86%) | 7 (29.16%) | 0.041 |
| 6 | Amikacin | 11 (47.82%) | 6 (25%) | 0.135 |
| 7 | Pipracillin-tazobactam | 16 (69.56%) | 9 (37.5%) | 0.041 |
| 8 | Cefepime | 19 (82.60%) | 13 (54.16%) | 0.050 |
| 9 | Ceftazidime | 19 (82.60%) | 13 (54.16%) | 0.050 |
| 10 | Azetronam | 20 (86.95%) | 9 (37.5%) | 0.001 |
| 11 | Coilstin | 8 (34.78%) | 10 (41.6%) | 0.766 |
| P value˂0.05 significant | ||||
The percentages of the virulence genes among the isolated strains were determined, toxA gene was detected in 45 isolates (95.7%), while algD gene in 42 isolates (89.4%), pslA in 42 isolates (89.4%) %), pelA in 41 isolates (87.2%) and nan1gene in 19 isolates (40.4) (Table 7).
| Table 7: The percentages of the virulence genes among the isolated strains: | |||
| No. | Genes | Positive | Negative |
| No. (%) | No. (%) | ||
| 1 | toxA | 45 (95.7%) | 2 (4.3%) |
| 2 | algD | 42 (89.4%) | 5 (10.6%) |
| 3 | pslA | 42 (89.4%) | 5 (10.6%) |
| 4 | pelA | 41 (87.2%) | 6 (12.8%) |
| 5 | nan1 | 19 (40.4%) | 28 (59.6%) |
The percentage of virulence genes in different hospital wards were determined. It was higher in ICU, surgery and Burn Unit than other wards with statistically insignificant P. value (Table 8).
| Table 8: The percentage of virulence genes in different hospital wards.. | ||||||||
| Genes | Different hospital wards | |||||||
| ICU No. (%) | Burn unit No. (%) | Surgry No. (%) | NICU No. (%) | Internal medicine No. (%) | Pediatric department No. (%) | Total | P value | |
| toxA | 14 (31.1%) | 7 (15.5%) | 9 (20%) | 5 (11.1%) | 7 (15.5%) | 3 (6.66%) | 45 | 0.486 |
| nan1 | 12 (28.5%) | 6 (14.28%) | 10 (23.8%) | 5 (11.9%) | 6 (14.28%) | 3 (7.14%) | 42 | 0.825 |
| algD | 8 (42.1%) | 5 (26.31%) | 4 (21.05%) | 1 (5.26%) | 1 (5.26%) | 0 (0%) | 19 | 0.080 |
| pelA | 13 (31.7%) | 5 (12.19%) | 9 (21.95%) | 5 (12.19%) | 6 (14.63%) | 3 (7.32%) | 41 | 0.431 |
| pslA | 13 (30.9%) | 7 (16.6%) | 9 ( 1.42%) | 4 (9.52%) | 6 (14.28%) | 3 (7.14%) | 42 | 0.766 |
The percentages of virulence genes in terms of the site of infection were determined. It was higher in pus of the wounds and followed by urine, sputum and blood (Table 9).
| Table 9: The percentages of virulence genes according to the different sites of infection. | |||||
| Genes | The different sites of infection | ||||
| Pus | Urine | Sputum | Blood | P value | |
| toxA positive No. (%) negative No. (%) | 17 (94.4%) 1 (5.55%) | 14 (93.3%) 1 (6.66%) | 9 (100%) 0 (0%) | 5 (100%) 0 (0%) | 0.050 |
| algD positive No. (%) negative No. (%) | 17 (94.4%) 1 (5.55%) | 13 86.66%) 2 (13.33%) | 8 (88.8%) 1 (11.1%) | 4 (80%) 1 (20%) | 0.025 |
| nan1 positive No. (%) negative No. (%) | 10 (55.5%) 8 (44.4%) | 8 (53.33%) 7 (46.66%) | 1 (11.1%) 8 (88.8%) | 0 (0%) 5 (100%) | 0.785 |
| pelA positive No. (%) negative No. (%) | 17 (94.4%) 1 (5.55%) | 15 (100%) 0 (0%) | 6 (66.66%) 3 (33.33%) | 4 (80%) 1 (20%) | 0.050 |
| pslA positive No. (%) negative No. (%) | 16 (88.8%) 2 (11.1%) | 13 (86.66%) 2 (13.33%) | 8 (88.8%) 1 (11.1%) | 4 (80%) 1 (20%) | 0.959 |
| Total No. (%) | 18 (38.3%) | 15 (31.9%) | 9 (19.1%) | 5 (10.6%) | |
| P value˂0.05 significant | |||||
It was found out that certain biofilm-producing strains were specifically connected to certain virulence genes. Ninteen strains out of 23 (82.6%) express pelA gene, while all the strains express pslA gene with statisticaly significant P. value (P ≤0.05) (Table 10).
| Table 10: The percentages of pelA and pslA genes among biofilm producer and biofilm non producer strains: | |||
| Genes | Biofilm producer n=23 | Non biofilm producer n=24 | P value |
| pelA: positive No. (%) negative No. (%) | 19 (82.6%) 4 (17.3%) | 23 (95.8%) 1 (4.1%) | 0.142 |
| pslA: positive No. (%) negative No. (%) | 23 (100%) 0 (0%) | 19 (79.1%) 5 (20.8%) | 0.021 |
| Total No. (%) | 23 (48.9%) | 24 (51.1%) | |
| P value˂0.05 significant | |||
The percentage of virulence genes among MDR and non-MDR isolates were determined. Twenty seven strains of 28 total MDR bacteria were positive to toxA, algD and pslA genes (96.4%) with statistically significant P. value (P. ≤0.05) for algD and pslA genes. Also, 25 strains (89.3%) were positive to pelA and 13 strains were positive to nan1 gene (46.4%) (Table 11).
| Table 11: The percentage of virulence genes among Multi Drug Resistant and Non- Multi Drug Resistant isolates. | ||||
| Genes | Multi Drug Resistant No. (%) | Non Multi Drug Resistant No. (%) | Total No. | P value |
| toxA | 27 (96.4%) | 18 (94.7%) | 45 | 0.778 |
| PslA | 27 (96.4%) | 15 (78.9%) | 42 | 0.050 |
| algD | 27 (96.4%) | 15 (78.9%) | 42 | 0.050 |
| pelA | 25 (89.3%) | 16 (84.2%) | 41 | 0.609 |
| nan1 | 13 (46.4%) | 6 (31.6%) | 19 | 0.309 |
| Total | 28 | 19 | 47 | |
| P value˂0.05 significant | ||||
In regard to the relation between MDR, biofilm production and virulence genes of P. aeruginos, MDR and biofilm producer strains were found the highest groups which carried virulence genes (Table 12).
| Table 12: The relation between Multi Drug Resistant , biofilm production and virulence genes. | ||||||
| Genes | Multi Drug Resistant & biofilm producer No. (%) | Multi Drug Resistant & non biofilm producer No. (%) | Non Multi Drug Resistant & biofilm producer No. (%) | Non Multi Drug Resistant & non biofilm producer No. (%) | Total | P value |
| toxA | 18 (40%) | 9 (20%) | 4 (8.88%) | 14 (31.1%) | 45 | 0.006 |
| algD | 18 (42.85%) | 9 (21.42%) | 4 (9.5%) | 11 (26.2%) | 42 | 0.050 |
| pslA | 18 (42.85%) | 9 (21.42%) | 5 (11.9%) | 10( 23.8%) | 42 | 0.009 |
| pelA | 16 (39%) | 9 (21.95%) | 3 (7.31%) | 13 (31.7%) | 41 | 0.050 |
| nan1 | 9 (47.3%) | 4 (21%) | 2 (10.52%) | 4 (21%) | 19 | 0.141 |
| P value˂0.05 significant | ||||||
P. aeruginosa is a Gram-negative bacterium possessing pili, flagella, (lipopolysaccharide) LPS [16]. It is difficult to be eradicated due to its ability to produce biofilm [17]. It infects the pulmonary tract, urinary tract, burn and becomes a major cause of HAI worldwide [18]. Eradication of P. aeruginosa has become increasingly difficult due to its remarkable capacity to resist antibiotics. P. aeruginosa strains are known to utilize their high levels of intrinsic and acquired resistance mechanisms to counter most antibiotics. In addition, adaptive antibiotic resistance of P. aeruginosa is a recently-characterized mechanism (4) which includes biofilm-mediated resistance and formation of multi-drug-tolerant cells, and is responsible for the relapse of infections. The discovery and development of alternative therapeutic strategies that present novel avenues against P. aeruginosa infections demand a more increasing attention [19].
This study aimed at determining the prevalence of certain virulence genes in clinical isolates of P. aeruginosa and to correlate the presence of these genes in different sites of infection with antimicrobial resistance.
A total of 296 specimens were collected from patients with nosocomial infections in SCUH. From the specimens, 47 P. aeruginosa strains were isolated (15.9%). In the study of Mahmoud et al. [20] at Menofia University hospital, P. aeruginosa was found to account for 19.8% of nosocomial infections. Wassef et al. [21] in Cairo, Egypt, isolated P. aeruginosa with a prevalence rate of 20.7%. Lower isolation rate (6.67%), was reported by a number of studies such as Khan et al. [22] in Pakistan. The percentage of P. aeruginosa is variable in various studies in literature. This might be attributed to drug overuse and hospital policy in management of such cases. Moreover, geographic climatic and hygienic factors may also be correlated with the relative variability of results among different areas [19].
In this study, the highest percentages of P. aeruginosa were from ICU, Surgery Department and Burn Unit (29.8%, 21.3% and 14.5% respectively). This is comparable with several studies such as Ikeno et al., Gad et al. and Pourshafie et al [23-25], which can be seen as ringing danger alarms for the widespread organism. This can be interpreted in terms of anaerobic growth of the bacteria obtaining energy from oxidation of sugars thus rendering difficulty of eradication [21]. Amany et al. 2017 [26], found that acquired infection rate in ICU was higher than other hospital wards. The ubiquitous nature, including the ability to survive in a moist environment and resistance to many antibiotics, makes P. aeruginosa a common pathogen in the ICUs of hospitals.
From a different perspective, the cause of the widespread existence of P. aeruginosa in the Burn Unit was due to impairment of the skin barrier in burn victims, debridement and manipulation of the burn site [27,28,29,30,31]. Also, it can be attributed to the production of proteases that can alter the host’s physical barriers by splitting proteins with the production of amino-acids that allow the deep infiltration of the bacteria. Exotoxin A halts the synthesis of proteins and the hemolysins break down lipids in epithelial cells in order to permit the bacteria for more penetration and spreading [30].
Infections caused by P. aeruginosa are often severe due to limited antibiotic susceptibility and emergence of antibiotic resistance [30]. NNIS data (i.e. within the period from 1998 to 2003) [33] showed the highest prevalence of resistance rates of P. aeruginosa against antibiotics was to Imipenem, Ciprofloxacin, and Ceftazidime by 15%, 9%, and 20%, respectively. Also, there was evidence that the highest rates were against Cefepime and Ceftazidime (68.1% for each) which was in convenience with Mahmoud et al. and Oni et al [20,34]. This is explained by Cefepime which has reliable activity against P. aeruginosa because of the drug chemical structure allowing binding to penicillin-binding proteins and penetrating through the outer membrane of Gram-negative bacteria more rapidly than most Cephalosporins. Moreover, Cefepime is also stabler to β-lactamase hydrolysis [35].
From the previous explanation, we had expected to find high sensitivity level to Cefepime, but we found a high level of susceptibility to the drug. This may be attributed to the production of high levels of AmpC β-lactamases by some strains that become fully Cefepime-susceptible. This phenotype is usually found among ICU patients who frequently receive multiple treatment courses of expanded-spectrum β-lactam antibiotics for prolonged periods.
For the Ceftazidime that has a C=N-OCH3 group in its chemical structure which provides stability against β-, acts as a penicillin-binding proteins inhibitor (37). P. aeruginosa resistance against Ceftazidime arise from the horizontal acquisition of β-lactamases, altered expression of class C β-lactamase AmpC [36].
In the current study, Imipenem and Ciprofloxacin were the most effective drugs against P. aeruginosa. The sensitivity of Imipenem and Ciprofloxacin were 85.1% and 68.1% respectively due to their ability in producing several different porins as outer membrane porin D (OprD) so they can cross the outer membrane of P. aeruginosa [37].
The variations in the results of the antibiotic resistance might be referred to the difference in the pattern of drug use in different parts of the world and due to the several mechanisms that have been reported for P. aeruginosa, including: 1) Reduced expression or loss of OprD porin causing reduced antibiotic permeability, 2) Over-expression of MexAB-OprM pump which increases antibiotic efflux, 3) Production of β-lactams and aminoglycosides inactivating enzymes, 4) Mutations of gyrases and topoisomerases which cause fluoroquinolone resistance. These mechanisms in combination lead to multiple drug resistance [38,39].
What adds to the problem of P. aeruginosa causing HAIs is the emergence of MDR strains. In this study, a high prevalence of MDR P. aeruginosa strains (59.6%) was reported, and the highest prevalence of resistance for MDR strains was to Azetronam and Cefepime (92.85% for each). Similarly, a high rate of MDR was reported in a number of studies. For instance, in Turkey, Ünan and Gnsern [40] reported that 60% of their P. aeruginosa isolates were MDR; in Egypt, Mahmoud et al. [20] found that MDR P. aeruginosa were (52%) among their isolates.
The evolution of numerous MDR P. aeruginosa can be explained by the ability of the bacteria to acquire antibiotic resistance through horizontal gene transfer and spontaneous mutation [41].
The TCP assay is a simple and rapid method to quantify biofilm formation. We found that 13 strains out of 47 (27.7%) were strong biofilm producers, 10 (19.1%) moderate and 24 (51.1%) weak or non-biofilm producers.
It is noteworthy that literature shows results quite consistent with the present ones. In Egypt, Hisham et al. [42], found that 16 isolates (80%) were strong biofilm producers; 2 isolates (10%) were moderate and another 2(10%) were weak. Also, Abd El-Galil et al. [43]. found that 42 isolates (84%) were strong biofilm producers; 4 isolates (8%) were moderate ones and 4 isolates (8%) were weak ones. With no much difference from the present study results, Maita and Boonbumrung found that 60% of strains were strong biofilm producers from a total of 136 strains; 11% were moderate and 22% non-producers.
In the present study, biofilm production was higher among blood and sputum than other specimens. The cause can be ascribed by the observation that biofilm-colonizing devices implanted inside the body or forming a connection between inner and outer surface of the body where a normal microbial flora is present, are to blame. This type of infections is particularly associated with orthopedic devices and intravenous catheters.
Statistical analysis of this study showed significant association (P value ≤0.05) between biofilm production and MDR. 40.7% were MDR and biofilm producers and 19.1% MDR and non-producers.
Previous studies have shown that biofilm formation is higher in MDR strains [44-46]. This may be referred to the protective nature of the biofilm that makes the bacteria (i.e. growing intrinsically) resistant to many antibiotics up to 1000 times higher than normal levels. Another reason is the slow growth rate of the bacteria in the presence of antibiotic degradation mechanisms.
In this study, the resistance pattern to Ciprofloxacin, Gentamicin, Cefepime, Ceftazidime, Azetronam and Pipracillin-Tazobactam was significantly higher (p value ≤0.05) to biofilm than non-biofilm-producing strains.
It is worth mentioning that Maita and Boonbumrung found that the antibiotic resistance to Amikacin, Gentamicin, Ceftazidime, Cefepime, Imipenem, Meropenem, Cefoperazone/Sulbactam and Piperacillin/Sulbactam was higher among biofilms producing P. aeruginosa than that which was non-producers. However, Levofloxacin and Ciprofloxacin were found to exhibit similar resistance in both biofilm producers and non-producers. In the case of the biofilm-producing strains, relating results in the present study found an increase more than 50% of the resistance to Ceftazidime (52.8%), Levofloxacin (51.9%), Ciprofloxacin (51.9%) and Cefoperazone/Sulbactam (55.6%).
In the present study, the percentages of a number of P. aeruginosa virulence genes (toxA, nan1, algD, pelA and pslA genes) and their relation to the site of infection were detected. It is known toxA gene encodes exotoxin A that acts as a major virulence factor of P. aeruginosa. The gene was detected in 45 isolates (95.7%). Other studies reported the same results as Qin et al., Lavenir et al. and Nikbin et al. [47-49].
As for algD gene, it encodes GDP-mannose 6-dehydrogenase enzyme which catalyzes the oxidation GDP-D-mannose to GDP-D-mannuronic acid, a precursor for alginate polymerization. The alginate layer causes a mucoid phenotype and provides a protective barrier against host immune defenses and antibiotics. In the present study, evidently, it was detected in 42 isolates (89.4%). Al-Dahmoshi et al. [14], and Ra’oof revealed that all isolates had the algD gene and showed high capacity of alginate biofilm formation which interfered with response of the P.aeruginosa isolates to antibiotics.
PelA gene, which is necessarily associated to the polysaccharide stage of biofilm development and maintenance, was detected in 41 isolates (87.2%) and in 19 biofilm- producing strains out of 23 (82.6%). This result corresponds to Sharma and Choudhury’s [50].
Equally important, we found pslA in 42 isolates (89.4%). Moreover, all 23 biofilm- producing strains expressed pslA gene with statisticaly significant P. value (P ≤0.05) in a manner comparable with Maita and Boonbumrung.
Several studies suggest that the nan1 gene encodes neuraminidase which has a role in enhancing bacterial adhesion. Nan1gene was detected in 19 isolates (40.4%), e.g. Strateva, Mitov and Ra’oof [6,51,52].
The percentages of all virulence genes were high in ICU, surgery and Burn Unit. The differences in the distributions of virulence factor genes in the populations strengthen the probability that some P. aeruginosa strains are better adapted to the specific conditions found in specific infectious sites [53].
The study results were limited to a sample of 47 strains. The reason behind this was due to insufficient financial support and the short duration of the study period. However, we anticipate the expansion of the work on a large sample size in a longer period.
We conclude that P. aeruginosa is seen an extremely versatile micro-organism. It will continue to surprise us yet with unappreciated modes of niche adaptation, lifestyle, and pathogenicity. We conclude that there is relationship between virulence genes and biofilm formation in P. aeruginosa. We advise the expansion of work on a large sample size in a longer period of time in order to study other virulence genes.
- Askoura M, Mottawea W, Abujamel T, Taher I. Efflux pump inhibitors (EPIs) as new antimicrobial agents against Pseudomonas aeruginosa. Libyan J Med. 2011; 6: 5870. [PUBMED]
- Aly NY, Al-Mousa HH, Al Asar el SM. Nosocomial Infections in a Medical-Surgical Intensive Care Unit. Med Princ Pract. 2008; 17: 373-377. [PUBMED]
- Nasser S, Mabrouk A, Maher A. Colonization of burn wounds in Ain Shams University burn unit. Burns. 2003; 29: 229-233. [PUBMED]
- Falagas ME, Koletsi PK, Bliziotis IA. The diversity of definitions of multidrug-resistant (MDR) and pandrug-resistant (PDR) Acinetobacter baumannii and Pseudomonas aeruginosa. J. Med. Microbiol. 2006; 55: 1619–1629. [PUBMED]
- Hancock RE, Speert DP. Antibiotic resistance in Pseudomonas aeruginosa: Mechanisms and impact on treatment. Drug Resis update. 2000; 3: 247-255. [PUBMED]
- Mitov I, Strateva T, Markova B. Prevalence of virulence genes among bulgarian nosocomial and cystic fibrosis isolates of Pseudomonas aeruginosa. Braz J Microbiol. 2010; 41: 588–595. [PUBMED]
- Ryder C1, Byrd M, Wozniak DJ. Role of polysaccharides in Pseudomonas aeruginosa biofilm development. J Curr Opin Microbiol. 2007; 10: 644-648. [PUBMED]
- Solano C, Echeverz M, Lasa I. Biofilm dispersion and quorum sensing. J Curr Opin Microbiol. 2014; 18: 96-104. [PUBMED]
- Ghafoor A, Hay ID, Rehm BH. Role of exopolysaccharides in Pseudomonas aeruginosa biofilm formation and architecture. J Appl Environ Microbiol. 2011; 77: 5238–5246. [PUBMED]
- Rasamiravaka T, Labtani Q, Duez P, El Jaziri M. The Formation of Biofilms by Pseudomonas aeruginosa: A Review of the Natural and Synthetic Compounds Interfering with Control Mechanisms. J Bio Med Res Int. 2015; 759348: 17. [PUBMED]
- Govan J. Pseudomonas, Stenotrophomonas, Burkholderia. In: College J, Dugid J, Fraseer A, Marmion B (eds). Singapore: Churchill Livingstone. Mackie and McCartney. 14th ed. 1996; 23: 413-424.
- Janet A, Audrey N, Abbott A, Antonara S, Bobenchik A. CLSI AST News Update. J.CLSI Subcommittee on Antimicrobial Susceptibility Testing. 2017; 2: 1-17.
- Christensen G, Simpson W, Younger J, Baddour L, Barrett F. et al. Adherence of coagulase-negative staphylococci to plastic tissue culture plates: a quantitative model for the adherence of staphylococci to medical devices. J Cli Microbial. 1985; 22: 996-1006. [PUBMED]
- Al-Dahmoshi H. Genotypic and Phenotypic Investigation of Alginate Biofilm Formation among Pseudomonas Aeruginosa Isolated from Burn Victims in Babylon, Iraq. J Science J Microbiol. 2013.
- Maita P, Boonbumrung K. Association between biofilm formation of Pseudomonas aeruginosa clinical isolates versus antibiotic resistance and genes involved with biofilm. J Chem Pharm Res. 2014; 6: 1022-1028.
- Harrison F. Microbial ecology of the cystic fibrosis lung. J Microbiol. 2007; 153: 917–923. [PUBMED]
- Akhand S, Pettit R, Gardner T, Anderson G. New treatments in development for Pseudomonas aeruginosa infections in the lungs of individuals with cystic fibrosis. J Email Alerts. 2014; 71-78. [PUBMED]
- Gomez M, Neyfakh A. Genes involved in intrinsic antibiotic resistance of Acinetobacter baylyi. J Antimicrob Agents Chemother. 2006; 50: 3562–3567. [PUBMED]
- Pang Z, Raudonis R Glick BR, Lin TJ, Cheng Z. Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. J Biotechnology Advances. 2019; 37: 177-192. [PUBMED]
- Mahmoud AB, Zahran WA, Hindawi GR, Labib A,Z Galal R. Prevalence of Multidrug-Resistant Pseudomonas aeruginosa in Patients with Nosocomial Infections at a University Hospital in Egypt, with Special Reference to Typing Methods. J Virol Microbiol. 2013; 290047.
- Wassef M, El Mahallawy H, Zafer MM, Ghaith D, Abdel Hamid R. Lab Based Surveillance of Multidrug Resistant Pseudomonas aeruginosa in Cairo University Hospitals, Egypt. J Microbiol Exp. 2015; 2: 00039.
- Khan HA, BaigFK, Mehboob R. Nosocomial infections: Epidemiology, prevention, control and surveillance. Asian Pac J Trop Biomed. 2017; 7: 478-482. [PUBMED]
- Ikeno T, Fukuda K, Ogawa M, Honda M, Tanabe T, et al. Small and rough colony Pseudomonas aeruginosa with elevated biofilm formation ability isolated in hospitalized patients. J Microbiol Immunol. 2007; 51: 929-938. [PUBMED]
- Gad GF, El-Domany RA, Zaki S, Ashour HM. Characterization of Pseudomonas Aeruginosa Isolated from Clinical and Environmental Samples in Minia, Egypt: Prevalence, Antibiogram and Resistance Mechanisms. J. Antimicrob Agents Chemother. 2007; 60: 1010– 1017. [PUBMED]
- Pourshafie M, Mousavi S, Parzadeh M. Ribotyping and increasing trend of antibiotic resistance of Pseudomonas aeruginosa isolated in Iran. Braz J Microbiol. 2007; 38: 355.
- Abaza AF, El Shazly SA, Selim HSA, Aly GSA. Metallo-Beta-Lactamase Producing Pseudomonas aeruginosa in a Healthcare Setting in Alexandria, Egypt. Polish J Microbiol. 2017; 66: 297–308. [PUBMED]
- Kennedy AM, Elward AM, Fraser VJ. Survey of knowledge, beliefs, and practices of neonatal intensive care unit healthcare workers regarding nosocomial infections, central venous catheter care, and hand hygiene. J Infect Control Hosp Epidemiol. 2004; 25: 747-752. [PUBMED]
- Pathmanathan SG, Samat NA, Mohamed R. Antimicrobial Susceptibility of Clinical Isolates of Pseudomonas aeruginosa from a Malaysian Hospital. Malays J of Med Sci. 2019; 16: 146-152. [PUBMED]
- Taherzadeh S, Soheili F, Deilami Z, Salimizand H, Heidari A. Incidence of nosocomial infections caused by Pseudomonas aeruginosa among burn patients at Kurdistan province. Glo Res J Microbiol. 2011; 2: 35-38.
- Japoni A, Farshad S, Alborzi A. Pseudomonas aeruginosa: Burn Infection, Treatment and Antibacterial Resistance. Iran Red Crescent Med J. 2009; 11: 244-253.
- Church D, Elsayed S, Reid O, Winston B, Lindsay R. Burn wound infections. J Clin Microbiol Rev. 2006; 19: 403-434. [PUBMED]
- Allegranzi B1, Pittet D. Preventing infections acquired during health care delivery. J Lancet. 2008; 372: 1719-1720. [PUBMED]
- NNIS. National Nosocomial Infections Surveillance (NNIS) System Report, data summary from January 1992 through June 2004, issued October 2004. Am J Infect Control. 2004; 32: 470-485. [PUBMED]
- Oni A, Nwaorgu O, Bakare R, Ogunkunle M, Toki R. The Discharging Ears in Adults in Ibadan, Nigeria; Causative Agents and Antimicrobial Sensitivity Pattern. Afr J Clin Exp Microbiol. 2002; 3: 3-5.
- Jacoby GA. AmpC β Lactamases. J Clin Microbiol Rev. 2009; 22: 161-182. [PUBMED]
- Van Eldere J. Multicentre surveillance of Pseudomonas aeruginosa susceptibility patterns in nosocomial infections. J Antimicrob Chemother. 2003; 51: 347-352. [PUBMED]
- Delcour AH. Outer Membrane Permeability and Antibiotic Resistance. Biochim Biophys Acta. 2010; 1794: 808–816. [PUBMED]
- Zeng ZR, Wang WP1, Huang M1, Shi LN1, Wang Y, et al. Mechanisms of carbapenem resistance in cephalosporin-susceptible Pseudomonas aeruginosa in China. J Diagn Microbiol Infect Dis. 2014; 78: 268-270. [PUBMED]
- Meletis G, Vavatsi N, Exindari M, Protonotariou E, Sianou E, et al. Accumulation of carbapenem resistance mechanisms in VIM-2-producing Pseudomonas aeruginosa under selective pressure. J Eur J Clin Microbiol Infect Dis. 2014; 33: 253-258. [PUBMED]
- Ünan D, Gnseren F. The Resistance of P. aeruginosa Strains Isolated from Nosocomial Infections against Various Antibiotics. J Micobiol Bult. 2000; 34: 255-260.
- Paramythiotou E, Lucet JC, Timsit JF, Vanjak D, Paugam-Burtz C, et al. Acquisition of Multidrug-Resistant Pseudomonas aeruginosa in Patients in Intensive Care Units: Role of Antibiotics with Antipseudomonal Activity. J Clin Infect Dis. 2004; 38: 670-677. [PUBMED]
- Hisham A, Fathy M, Eman M. Combating Pseudomonas aeruginosa Biofilms by Potential Biofilm Inhibitors. J Asian J Res Pharm Sci. 2012; 2: 66-72.
- Abd El Galil K, Abdel Ghani S, Sebak M, El-Naggar W. Detection of biofilm genes among clinical isolates of Pseudomonas aeruginosa recovered from some Egyptian hospitals. J Microbiol. 2013; 36: 86-101.
- Kwon AS, Park GC, Ryu SY, Lim DH, Lim DY, et al. Higher biofilm formation in multidrug-resistant clinical isolates of Staphylococcus aureus. J. Int. J. Antimicrob. Agents. 2008; 32: 68–72. [PUBMED]
- Reiter KC, DA Silva Paim TG, DE Oliveira CF, D'Azevedo PA. High biofilm production by invasive multiresistant staphylococci. APMIS. 2011; 119: 776–781. [PUBMED]
- Ghanbarzadeh Corehtash Z1, Khorshidi A1, Firoozeh F1, Akbari H2, Mahmoudi Aznaveh A. Biofilm Formation and Virulence Factors among Pseudomonas aeruginosa Isolated From Burn Patients. Jundishapur. J Microbiol. 2015; 8: e22345. [PUBMED]
- Qin X, Emerson J, Stapp J, Stapp L, Abe P, et al. Use of real-time PCR with multiple targets to identify Pseudomonas aeruginosa and other non-fermenting gram-negative bacilli from patients with cystic fibrosis. J Clin Microbiol. 2003; 4: 4312-4317. [PUBMED]
- Lavenir R, Jocktane D, Laurent F, Nazaret S, Cournoyer B. Improved reliability of Pseudomons aeruginosa PCR detection by the use of the specific ecfx gene target. J Microbiol Methods. 2007; 70: 20-29. [PUBMED]
- Nikbin VS, Aslani MM, Sharafi Z, Hashemipour M, Shahcheraghi F, et al. Molecular identification and detection of virulence genes among Pseudomonas aeruginosa isolated from different infectious origins. J Iran J Microbiol. 2012; 4: 118-123. [PUBMED]
- Sharma I, Choudhury D. Detection of PelA Gene in P. aeruginosa from Clinical Samples Using Polymerase Chain Reaction with Reference to Biofilm Production. J Indian J Med Res. 2015; 4: 119-121.
- Strateva T, Yordanov D. Pseudomonas aeruginosa – a phenomenon of bacterial resistance. J Med Microbiol. 2009; 58: 1133–1148. [PUBMED]
- Ra'oof W. Distribution of a algD, lasB, pilB and nan1 genes among MDR clinical isolates of pseudomonas aeruginosa in respect to site of infection. J Tikrit Med J. 2011; 17: 148- 160.
- Lanotte P, Watt S, Mereghetti L, Dartiguelongue N, Rastegar-Lari A, et al. Genetic features of Pseudomonas aeruginosa isolates from cystic fibrosis patients compared with those of isolates from other origins. J Med Microbiol. 2004; 153: 73–81. [PUBMED]
- Colvin KM, Gordon VD, Murakami K, Borlee BR, Wozniak DJ, et al. The pel polysaccharide can serve a structural and protective role in the biofilm matrix of Pseudomonas aeruginosa,. PLoS Pathogens. 2011; 7: e1001264. [PUBMED]
- Sabharwal N, Dhall S, Chhibber S, Harjai K. Molecular detection of virulence genes as markers in Pseudomonas aeruginosa isolated from urinary tract infections. Int J Mol Epidemiol Genet. 2014; 5: 125-134. [PUBMED]
- Sharma M, Pathak S, Srivastava P. Prevalence and antibiogram of Extended Spectrum β-Lactamase producing gram negative bacilli and further molecular characterization of ESBL producing Escherichia coli and Klebsiella spp. J Clin Diagn Res. 2013; 7: 2173–2177.